Relacja między mutacjami genu włóknisto-torbielowatego a idiopatycznym zapaleniem trzustki ad

DNA zostało również przebadane pod kątem mutacji G85E.21 Długość sekwencji tymidyn w intronie 8 genu CF TR została określona za pomocą trzech specyficznych dla allelu reakcji łańcuchowych polimerazy na próbkę. Powszechnym starterem do przodu był 5 TAATGGATCATGGGCCATGT3 . Startery odwrotne były odpowiednio 5 CCCCAAATCCCTGTTAAAAAC3 , 5 CCCCAAATCCCTGTTAAAAAAAC3 i 5 CCCCAAATCCCTGTTAAAAAAAAAC3 dla alleli 5T, 7T i 9T. Dla każdej reakcji zastosowano gen dystrofiny (ekson 16) jako wewnętrzną kontrolę amplifikacji.22 Sekwencja pięciu tymidyn w regionie poliT związana jest z niskim poziomem normalnego informacyjnego RNA CFTR (mRNA). Testy międzynabłonkowej donosowej różnicy potencjałów
Oceniono wpływ przeznabłonkowej różnicy potencjałów na nos w celu oceny transportu chlorku za pośrednictwem CFTR in vivo.23 Pokrótce, odpowiedzi bioelektryczne mierzono podczas perfuzji roztworami zawierającymi amiloryd, glukonian z dodatkiem amilorydu, izoproterenolu, glukonianu i amilorydu w celu określenia łącznego efektu usuwania chlorku. i aktywacja wewnątrzkomórkowego cyklicznego AMP.
Analiza statystyczna
Różnice między grupami porównano z testem sumy rang Wilcoxona.24 Wszystkie wartości P są dwustronne. Różnice pomiędzy oczekiwaną i obserwowaną częstością mutacji lub genotypów oceniano z rozkładem dwumianowym dla 54 alleli lub 27 pacjentów. Analiza ta zależy od wiarygodności danych dotyczących częstości występowania alleli CF TR. Oczekiwaną częstość występowania różnych nieprawidłowych alleli oszacowano następująco. Częstość mukowiscydozy wśród białych Amerykanów wynosi na 3003,6. Spośród 2200 białych osób, które zostały genotypowane w naszym centrum medycznym, składające się z pacjentów z mukowiscydozą i nosicielami, 17 mutacji, które testowaliśmy w obecnym badaniu, stanowiło 75 procent wszystkich alleli powodujących mukowiscydozę, a połowa wszystkich pacjentów z mukowiscydozą była homozygotyczna pod względem .F88,25. Częstość występowania allelu 5T wynosi 5 procent wśród białych badanych w naszym ośrodku medycznym22 i gdzie indziej.10-12 Zatem spodziewana częstotliwość genotypów składający się z jednej z testowanych mutacji na jednym chromosomie i allelu 5T na drugim chromosomie wynosi na 731 (2 × 3003-0,5 × 0,75 × 0,05). Wreszcie, pacjenci, którzy byli homozygotyczni pod względem .F508, byliby wykluczeni z tego badania, ponieważ ten genotyp prawie zawsze powoduje klinicznie znaczącą chorobę płuc. Zatem oczekiwana częstotliwość genotypów wpływających na oba allele (nosiciele mutacji CF TR na jednym chromosomie i allelu 5T na innym [1/731] plus osobnicy, którzy są homozygotycznymi i złożonymi heterozygotami dla badanych mutacji [0,752 / 3003] minus ci, którzy są homozygotyczni pod względem .F508 [0,5 / 3003]), wynoszą na 720 (1/731 + 0,752 / 3003 – 1/6006).
Wyniki
Tabela 2. Tabela 2. Związek nieprawidłowych genotypów CF TR z idiopatycznym zapaleniem trzustki. Tabela podsumowuje genotypy CF TR dla 27 pacjentów z idiopatycznym zapaleniem trzustki. Wykryto trzy różne mutacje: .F508 u pięciu pacjentów, R117H w dwóch i N1303K w jednym, w sumie osiem. W związku z tym stwierdzono mutacje CF TR przy 11-krotności oczekiwanej częstotliwości (przedział ufności 95%, 5 do 23, P <0,001) (tabela 2).
Rysunek 1
[hasła pokrewne: dienogest, alprazolam, flexagen ]
[patrz też: rak szyjki macicy leczenie, rak tarczycy objawy, reumatoidalne zapalenie stawów leczenie ]